View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_261 (Length: 207)
Name: NF6819A_low_261
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_261 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 188
Target Start/End: Original strand, 47719774 - 47719942
Alignment:
| Q |
20 |
tccaaaaatatgcaccttagacgaataattgtgttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattattt |
119 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47719774 |
tccaacaaaatgcaccttagacgaataattgagttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattattt |
47719873 |
T |
|
| Q |
120 |
gttttgattctttcctggtcaatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47719874 |
gttttgattctttcctggtcaatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcct |
47719942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 40 - 188
Target Start/End: Original strand, 47726786 - 47726934
Alignment:
| Q |
40 |
acgaataattgtgttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
139 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47726786 |
acgaataattgagttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
47726885 |
T |
|
| Q |
140 |
aatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcct |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47726886 |
aatttgggcgtcttgcctttttggggttttgctgttgttgtagcctcct |
47726934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 40 - 167
Target Start/End: Original strand, 47748092 - 47748219
Alignment:
| Q |
40 |
acgaataattgtgttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
139 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47748092 |
acgaataattgagttattttatttttgatattctttggtggatgagtcagtgaaacggatacatttgttattgattatttgttttgattctttcctggtc |
47748191 |
T |
|
| Q |
140 |
aatttgggcgtcttgcctttttggggtt |
167 |
Q |
| |
|
||||||||||||||||||||| |||||| |
|
|
| T |
47748192 |
aatttgggcgtcttgccttttaggggtt |
47748219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University