View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_38 (Length: 376)
Name: NF6819A_low_38
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 21 - 365
Target Start/End: Complemental strand, 5678635 - 5678289
Alignment:
| Q |
21 |
aggtccttgagcctatactataactgactcattaatctttttctgcttcatttatagtgaggtagaaatctttctgtacttgccatggtggctcgtggtc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5678635 |
aggtccttgagcctatactataactgactcattaatctttttctgcttcatttatagtgaggtagaaatctttctgtacttgccatggtggatcgtggtc |
5678536 |
T |
 |
| Q |
121 |
tagacaaaactacaccatctgctagtgacttgtctgtgaagaagcaagagcttctatctagtgccatgaaaagaacaagtgactggtata--nnnnnnna |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5678535 |
tagacaaaactacaacatctgctagtgacttgtctgtgaagaagcaagagcttctatctagtgccatgaaaagaacaagtgactggtatattttttttta |
5678436 |
T |
 |
| Q |
219 |
tgtttatgtatatatatgtcaaatgtacttgacacttttcttgtgcatgttcttgtttgctaacttttgttggattttagtaactgaaaccaatgagttg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678435 |
tgtttatgtatatatatgtcaaatgtacttgacacttttcttgtgcatgttcttgtttgctaacttttgttggattttagtaactgaaaccaatgagttg |
5678336 |
T |
 |
| Q |
319 |
tattgcttaattataggattttttctaaggagattccaagtgatgtc |
365 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5678335 |
tattgcttaattataggattttttctcaggagattccaagtgatgtc |
5678289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University