View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_65 (Length: 318)
Name: NF6819A_low_65
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 27 - 142
Target Start/End: Original strand, 16374597 - 16374712
Alignment:
| Q |
27 |
aaaagtatatgctgaaattttaacatgagatattcatatatacttcctactgaatcatattatttgtcattgtttttggtttcaactgggagagcagtgg |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16374597 |
aaaagtatatgctgaaattttaacatgagatattcatatatacttcctactgaatcatattatttgtcattgtttttggtttcaactgggagagcagtgg |
16374696 |
T |
|
| Q |
127 |
tataattctttgcgaa |
142 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
16374697 |
tataattcttcgcgaa |
16374712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 166 - 312
Target Start/End: Complemental strand, 16369289 - 16369143
Alignment:
| Q |
166 |
gagtcaaagaaggcatattttgagcaaatggaagaaattcttgtgaggttggaagatgtgatcaacaaatacagtgaaggaaatgtcttttttggaggag |
265 |
Q |
| |
|
|||||||||||| | |||||||| || | | |||| | ||| ||| |||||||||||| | ||||| ||||| |||||| | |||||||||||||| |
|
|
| T |
16369289 |
gagtcaaagaagaaacattttgaggaactagcagaagtgcttttgaagttggaagatgtattgaacaagagcagtggaggaaaggacttttttggaggag |
16369190 |
T |
|
| Q |
266 |
agaaaattggatttcttgatattgcttttgggtgctatttgaattgg |
312 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||| |||| |
|
|
| T |
16369189 |
agaaaattggatttgttgatattgcttttggatgctatttgagttgg |
16369143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University