View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_78 (Length: 301)
Name: NF6819A_low_78
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_78 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 25 - 149
Target Start/End: Original strand, 10368671 - 10368795
Alignment:
| Q |
25 |
atcatctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatt |
124 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368671 |
atcatctccttcatcacaacccgtactgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatt |
10368770 |
T |
 |
| Q |
125 |
tcgatctcaccccttatatatatat |
149 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10368771 |
tcgatctcaccccttatatatatat |
10368795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 139 - 181
Target Start/End: Original strand, 10368827 - 10368869
Alignment:
| Q |
139 |
tatatatatatgcgtgtgtgtgtcttaaggaacaattgtggag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368827 |
tatatatatatgcgtgtgtgtgtcttaaggaacaattgtggag |
10368869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 66 - 139
Target Start/End: Original strand, 11659585 - 11659658
Alignment:
| Q |
66 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcacccctt |
139 |
Q |
| |
|
|||||||||||| ||||||| |||||||| | ||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
11659585 |
attgaaaaggacagcaagaacaagaaggaggctactatttcaaggtatgggtttgcatttcgatctcactcctt |
11659658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 66 - 139
Target Start/End: Original strand, 11668754 - 11668827
Alignment:
| Q |
66 |
attgaaaaggacggcaagaagaagaaggaagttactatttctaggtatgggtttgcatttcgatctcacccctt |
139 |
Q |
| |
|
|||||||||||| |||| ||||||||||| | ||||||||| |||||| |||||||||||||||||||| |||| |
|
|
| T |
11668754 |
attgaaaaggacagcaaaaagaagaaggaggctactatttcaaggtatcggtttgcatttcgatctcactcctt |
11668827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 53239215 - 53239290
Alignment:
| Q |
29 |
tctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
104 |
Q |
| |
|
|||||||||| ||||| | |||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
53239215 |
tctccttcattgcaaccagcgctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
53239290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 2170330 - 2170405
Alignment:
| Q |
29 |
tctccttcatcacaacccgtgctgtagtggtatgaaaattgaaaaggacggcaagaagaagaaggaagttactatt |
104 |
Q |
| |
|
|||||||||| ||||| | |||| |||||| ||||||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
2170330 |
tctccttcattgcaaccagcgctgcagtggtctgaaaattgaaaaggacagcaagaagaagaaagaagctactatt |
2170405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University