View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_95 (Length: 283)
Name: NF6819A_low_95
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_95 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 26 - 266
Target Start/End: Complemental strand, 40586365 - 40586119
Alignment:
| Q |
26 |
ctccctcttgaatgaatcttttactatatttcttccttttccaggagttgaaaaaatgaatggaagtgctttgttctgtttgtagaatttggcacagaaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586365 |
ctccctcttgaatgaatcttttactatatttcttccttttccaggagttgaaaaaatggatggaagtgctttgttctgtttgtagaatttggcacagaaa |
40586266 |
T |
|
| Q |
126 |
aataatacttttgacttagttattttataatgccagttccacttgctccttatccaactccacctccagctcctgctccagc------tccatatacaac |
219 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40586265 |
aataatacttttgacttagttcttttataatgccagttccacttgctccttatccaactccacctccagctcctgctccagctccagctccatatacaac |
40586166 |
T |
|
| Q |
220 |
acctccaacaaatggtatcttaacctttctttttctctgtgcttgat |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586165 |
acctccaacaaatggtatcttaacctttctttttctctgtgcttgat |
40586119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University