View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819A_low_98 (Length: 278)
Name: NF6819A_low_98
Description: NF6819A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819A_low_98 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 192 - 272
Target Start/End: Complemental strand, 29442391 - 29442311
Alignment:
| Q |
192 |
cttgattacgtgatcttggacgcacgaattatgaattactctgagttaatatccttcatttatgattctctctgttttatt |
272 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29442391 |
cttgattacatgatcttggacgcacgaattatgaattactctgagttaatatccttcatttatgattctctctgttttatt |
29442311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 120
Target Start/End: Complemental strand, 29442586 - 29442464
Alignment:
| Q |
1 |
aggattccggtaagtatctccggcggaagatccgccattggaaggaaggaaggaaggttctagttagggt-------ttagggtttttcctttcttcctc |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29442586 |
aggattccggtaagtatctccggcggaagatccaccattggaaggaagg----aaggttctagttagggtttaggccttagggtttttcctttcttcctc |
29442491 |
T |
|
| Q |
94 |
tccatgtacgacccaaatgcaacacag |
120 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
29442490 |
tccttgtacgacccaaatgcaacacag |
29442464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 29424136 - 29424226
Alignment:
| Q |
1 |
aggattccggtaagtatctccggcggaagatccgccattggaaggaaggaaggaaggttctagttagggtttagggtttttcctttcttcct |
92 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||| || ||||| ||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
29424136 |
aggattccggtgagtatctccggcggaagatccgtcattgg-agcttggaagttaggttctagctagggtttagagtttttcatttcttcct |
29424226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 29452578 - 29452537
Alignment:
| Q |
1 |
aggattccggtaagtatctccggcggaagatccgccattgga |
42 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29452578 |
aggataccggtaagtatctccggcggaagatccgccattgga |
29452537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 77
Target Start/End: Complemental strand, 29452503 - 29452466
Alignment:
| Q |
40 |
ggaaggaaggaaggaaggttctagttagggtttagggt |
77 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
29452503 |
ggaaggaaggaaggaaggttgtagctagggtttagggt |
29452466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000004; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 10354101 - 10354157
Alignment:
| Q |
32 |
ccgccattggaaggaaggaaggaaggttctagttagggtttagggtttttcctttctt |
89 |
Q |
| |
|
||||||||| |||||||||| ||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
10354101 |
ccgccattgtaaggaaggaatgaaggttct-gctagggtttagggtttttcatttctt |
10354157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 56
Target Start/End: Complemental strand, 9283399 - 9283343
Alignment:
| Q |
3 |
gattccggtaagtatctccggcggaagatc---cgccattggaaggaaggaaggaag |
56 |
Q |
| |
|
|||| ||| |||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9283399 |
gatttcggcaagtatgtccggcggaagatcggacgccattggaaggaaggaaggaag |
9283343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 10336751 - 10336785
Alignment:
| Q |
19 |
tccggcggaagatccgccattggaaggaaggaagg |
53 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
10336751 |
tccggcggaagatccgccattgtaaggaaggaagg |
10336785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University