View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819_low_16 (Length: 288)
Name: NF6819_low_16
Description: NF6819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 42183112 - 42182880
Alignment:
| Q |
1 |
agaaatgttgtgaaaaggttgaaaatttaaggatacaccgccattatcaatgatagcattagcacctagagcagaagaatcacccccaaaagacatgttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42183112 |
agaaatgttgtgaaaaggttgaaaatttaaggatacaccaccattatcaatgatagcattagcacctagagcagaagaatcacccccaaaagacatgttg |
42183013 |
T |
|
| Q |
101 |
tatgttgtgggaccataaccatc------agcagcagaagcagaagaagaatcatgattatgaaaaaatgaacggtggtgatgattattagagaaacctt |
194 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42183012 |
tatgttgtgggaccataaccatcagcatcagcagcagaagcagaagaagaatcatgattatgaaaaaatgaacggtggtgatgattattagagaaacctt |
42182913 |
T |
|
| Q |
195 |
caaaactctgcaccgacccaacaacaatgttgg |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42182912 |
caaaactctgcaccgacccaacaacaatgttgg |
42182880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University