View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6819_low_19 (Length: 252)
Name: NF6819_low_19
Description: NF6819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6819_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 22055364 - 22055606
Alignment:
| Q |
1 |
ttattgcatccaaacctactattgtattataactattatataattcctctatagttgaatattattatcaggaacttagtaaacctagttaaatgtatga |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22055364 |
ttattgcatccaaacctactatcgtattataactattatataattcctctatagttgaatattattatcaggaacttagtaaacctagttaaatgtatga |
22055463 |
T |
|
| Q |
101 |
--taannnnnnnggttttgctgctcac---ttactaatctannnnnnngcttgacattacaccttattatagatgtatgcattaaatttgcagctgcacc |
195 |
Q |
| |
|
| ||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22055464 |
ttttttttttttggttttgctgctcactgtttactaatgtatttttttgcttgacattacaccttattatagatgtatgcattaaatttgcagctgcacc |
22055563 |
T |
|
| Q |
196 |
ttgatatttttatgtcccctcaataacctctcaatgtgatgtc |
238 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
22055564 |
ttgatatttttatgtcccctcagtaacctctcaatgtaatgtc |
22055606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University