View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6820_high_19 (Length: 240)
Name: NF6820_high_19
Description: NF6820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6820_high_19 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 240
Target Start/End: Original strand, 52261770 - 52261998
Alignment:
| Q |
12 |
atcatgagctcaacagggtgtatcatttgtgcttttgccgcgaacaactttgacattatgagcacctttaagttcacattggatgctcaatatgttgccc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52261770 |
atcatgagctcaacagggtgtatcatttgtgcttttgccgcgaacaactttgacattatgagcacctttaagttcacattggaagctcaatatgttgccc |
52261869 |
T |
 |
| Q |
112 |
tcactgaaatgctccgggtgtaacttattaatnnnnnnntgtgtggatgtaaattaacaaataccatatatgagaaatgatttgtagatatttaaatttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52261870 |
tcactgaaatgctccgggtgtaacttattaataaaaaaatgtgtggatgtaaattaacaaataccatatatgagaaatgatttgtagatatttaaatttt |
52261969 |
T |
 |
| Q |
212 |
gatgtcaaacacaacgtcatttgattttt |
240 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |
|
|
| T |
52261970 |
gatgtcaaacacaatgtcctttgattttt |
52261998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University