View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6820_high_8 (Length: 393)
Name: NF6820_high_8
Description: NF6820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6820_high_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 2e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 184 - 361
Target Start/End: Original strand, 30562859 - 30563036
Alignment:
| Q |
184 |
tttgctgagataacttctctgatcaccaatttttcttcttacatattcaactattaccagtcacgcacattaaatactaaagttagaaataagcaccatg |
283 |
Q |
| |
|
||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30562859 |
tttgctgagataacttcacataccaccaatttttcttcttacatattcaactattaccagccactcacattaaatactaaagttagaaataagcaccatg |
30562958 |
T |
|
| Q |
284 |
ttttgtttgtgtgctccttttctcttcattgttctgttcaagtacttcattgattcaatccttcactcaaaccccagt |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
30562959 |
ttttgtttgtgtgctccttttctcttcattgttctgttcaagtacttcattgattgaatccttaattcaaaccccagt |
30563036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University