View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6820_low_23 (Length: 243)
Name: NF6820_low_23
Description: NF6820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6820_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 34899074 - 34898846
Alignment:
| Q |
1 |
ttgttggaccgtcgacaacgggaataagatggtctggactggccataaggatggcaagattaggtcatggaaagtggatcaacaattttcgacccccttt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899074 |
ttgtttgaccgtcgacaacgggaataagatggtctggactggccataaggatggcaagattaggtcatggaaagtggatcaacaattttcgacccccttt |
34898975 |
T |
|
| Q |
101 |
aaggaaggtctttcttggcaggcacacagaggtcccgttcttgccatgatcataagcagctacggtaggcctctccctctagtagtcttttcaaaattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34898974 |
aaggaaggtctttcttggcaggcacacagaggtcccgttcttgccatgatcataagcagctacggtaggcctctccctctagtagtattttcaaaattaa |
34898875 |
T |
|
| Q |
201 |
gtgtatgtttggcgttgacaaaaattgat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34898874 |
gtgtatgtttggcgttgacaaaaattgat |
34898846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University