View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6828_high_11 (Length: 210)

Name: NF6828_high_11
Description: NF6828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6828_high_11
NF6828_high_11
[»] chr3 (3 HSPs)
chr3 (3-210)||(14688368-14688575)
chr3 (3-210)||(7360370-7360577)
chr3 (3-210)||(10787218-10787425)
[»] chr7 (2 HSPs)
chr7 (3-210)||(14328899-14329106)
chr7 (98-210)||(18166629-18166741)
[»] chr2 (3 HSPs)
chr2 (3-210)||(24954770-24954977)
chr2 (98-210)||(23195852-23195964)
chr2 (91-210)||(23621449-23621568)
[»] chr8 (1 HSPs)
chr8 (3-210)||(1730036-1730243)
[»] chr1 (2 HSPs)
chr1 (3-185)||(41375346-41375528)
chr1 (3-210)||(22081035-22081242)
[»] scaffold0108 (1 HSPs)
scaffold0108 (98-210)||(38974-39086)
[»] scaffold0064 (1 HSPs)
scaffold0064 (98-210)||(32652-32764)
[»] scaffold0897 (1 HSPs)
scaffold0897 (84-210)||(3832-3958)
[»] scaffold0051 (1 HSPs)
scaffold0051 (83-210)||(74498-74625)
[»] chr4 (2 HSPs)
chr4 (98-210)||(13284375-13284487)
chr4 (91-210)||(14562226-14562345)
[»] scaffold0304 (2 HSPs)
scaffold0304 (91-210)||(12276-12395)
scaffold0304 (91-210)||(18027-18146)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 3 - 210
Target Start/End: Original strand, 14688368 - 14688575
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    |||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||  |||||||| |||||||| ||| ||||||||||||||||    
14688368 atggacatcacatgttctgcattttgaggtgcacccagttcatgctggaccctgagccctgcatccctaccatccaaggtttgttgaagaatgccatgga 14688467  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggtctctt 202  Q
    ||||||||||||| ||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||||    
14688468 tgctggctctgtgaccgccctgtatttcgacgtgctgctgagggcgcttgacggtatcacacctgataccgctacactttttcatgatttttggtctctt 14688567  T
203 ttggagac 210  Q
    ||||||||    
14688568 ttggagac 14688575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 3 - 210
Target Start/End: Original strand, 7360370 - 7360577
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    ||||||| |||||||||||||| |||||||| ||||||||| ||||||||||||||||||   ||||||| |||||||| ||  ||||||||||||||||    
7360370 atggacaccacatgttctgcattttgaggtgtacccagttcatgctggatcctgagccctgcgtccctaccatccaaggtttcttgaagaatgccatgga 7360469  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggtctctt 202  Q
    ||||||||||||| |||| || ||||||||||| |||||||||||||| |||||| ||||||||||| ||||| ||||||||| |||||||| |||||||    
7360470 tgctggctctgtgaccgctctgtacttcgacgtactgctgagggcgcttgacggtgtcacacctgatgccgctgcactttttcatgatttcttgtctctt 7360569  T
203 ttggagac 210  Q
    ||||||||    
7360570 ttggagac 7360577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 3 - 210
Target Start/End: Complemental strand, 10787425 - 10787218
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    ||||||||||||||||||||||  ||||||| ||||||||| |||| || ||||||||||  || |||||  ||||||||||| || ||||||| |||||    
10787425 atggacatcacatgttctgcattctgaggtgtacccagttcatgctagaccctgagccctgcattcctaccgtccaaggcttgttgcagaatgctatgga 10787326  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggtctctt 202  Q
     |||||||||||| ||||||| |||||||| || ||||||||||||||  ||||| ||| || |||| |||||| |||||||| ||||||||||||||||    
10787325 cgctggctctgtgaccgccctgtacttcgatgtactgctgagggcgcttaacggtgtcagacttgattccgctagactttttcatgatttctggtctctt 10787226  T
203 ttggagac 210  Q
    ||||||||    
10787225 ttggagac 10787218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 3 - 210
Target Start/End: Original strand, 14328899 - 14329106
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    |||||||||||||||||||||| |||||||| ||||||||| ||||||| ||||||||||  |||||||| ||| |||| ||||||||||||||||||||    
14328899 atggacatcacatgttctgcattttgaggtgtacccagttcatgctggaccctgagccctgcatccctaccatctaaggtttgctgaagaatgccatgga 14328998  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggtctctt 202  Q
    ||||||||||||| |||| || ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||    
14328999 tgctggctctgtgaccgctctgtacttcgacgtactgctgagggcgcttgacggtatcacacctgatgccgctacactttttcatgatttctggtctctt 14329098  T
203 ttggagac 210  Q
    ||||||||    
14329099 ttggagac 14329106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 98 - 210
Target Start/End: Original strand, 18166629 - 18166741
Alignment:
98 atggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggt 197  Q
    ||||||||||| |||||| |||| || ||||| || ||  ||||||| ||||| ||||||||||| ||||||||||||  ||| ||   ||| || ||||    
18166629 atggatgctggttctgtgaccgctctttactttgatgtaatgctgagagcgcttgacggtatcactcctgataccgctgaactcttcaatgacttttggt 18166728  T
198 ctcttttggagac 210  Q
    |||||||||||||    
18166729 ctcttttggagac 18166741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 3 - 210
Target Start/End: Complemental strand, 24954977 - 24954770
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    ||||||| |||||||||||||| |||||||| ||||||||| || |||| |||||||| |  |||||||| |||||||||||||||||||||||||||||    
24954977 atggacaacacatgttctgcattttgaggtgtacccagttcatgttggaccctgagccttgcatccctaccatccaaggcttgctgaagaatgccatgga 24954878  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggtctctt 202  Q
    ||||||||||||| |||| || ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||    
24954877 tgctggctctgtgaccgctctgtacttcgacgtactgctgagggcgcttgacggtatcacacctgatgccgctacactttttcatgatttctggtctctt 24954778  T
203 ttggagac 210  Q
     |||||||    
24954777 ctggagac 24954770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 98 - 210
Target Start/End: Original strand, 23195852 - 23195964
Alignment:
98 atggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggt 197  Q
    ||||||||||| |||||| |||| || ||||| || ||  ||||||| ||||| ||||||||||| ||||||||||||  ||| ||   ||| || ||||    
23195852 atggatgctggttctgtgaccgctctttactttgatgtaatgctgagagcgcttgacggtatcactcctgataccgctgaactcttcaatgacttttggt 23195951  T
198 ctcttttggagac 210  Q
    |||||||||||||    
23195952 ctcttttggagac 23195964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 91 - 210
Target Start/End: Original strand, 23621449 - 23621568
Alignment:
91 gaatgccatggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgat 190  Q
    |||||| ||||||||||| |||||| |||| || ||||| || ||  ||||||| ||||| ||||||||||| ||||| ||||||  ||| ||   |||     
23621449 gaatgctatggatgctggttctgtgaccgctctttactttgatgtaatgctgagagcgcttgacggtatcactcctgacaccgctgaactcttcattgac 23621548  T
191 ttctggtctcttttggagac 210  Q
    || |||||||||||||||||    
23621549 ttttggtctcttttggagac 23621568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 3 - 210
Target Start/End: Complemental strand, 1730243 - 1730036
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    |||||||||| ||||||||||| |||||||| || |||||| ||||| | |||||||||| ||| |||||  ||||||| |||||||||||||| |||||    
1730243 atggacatcatatgttctgcattttgaggtgtactcagttcatgctgtaccctgagccctgtattcctaccgtccaaggtttgctgaagaatgctatgga 1730144  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggtctctt 202  Q
     |||||||||||| ||||||| |||||||| || |||||||||| |||  ||| | ||| || |||| |||||| |||||||| ||||||||||||||||    
1730143 cgctggctctgtgaccgccctgtacttcgatgtactgctgagggtgcttaacgatgtcagacttgattccgctagactttttcatgatttctggtctctt 1730044  T
203 ttggagac 210  Q
    ||||||||    
1730043 ttggagac 1730036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 3 - 185
Target Start/End: Original strand, 41375346 - 41375528
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    |||||||||| ||||||||||| |||||||| ||||||||| ||||||| ||||||||||  || |||||  |||||||||||||||||||||| |||||    
41375346 atggacatcatatgttctgcattttgaggtgtacccagttcatgctggaccctgagccctgcattcctaccgtccaaggcttgctgaagaatgctatgga 41375445  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttc 185  Q
     |||||||||||| ||||||| |||||||| || ||||||||||||||  ||||| ||| || |||| |||||| ||||||||    
41375446 cgctggctctgtgaccgccctgtacttcgatgtactgctgagggcgcttaacggtgtcagacttgattccgctagactttttc 41375528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 3 - 210
Target Start/End: Complemental strand, 22081242 - 22081035
Alignment:
3 atggacatcacatgttctgcatcttgaggtgcacccagttcctgctggatcctgagccctatatccctactatccaaggcttgctgaagaatgccatgga 102  Q
    |||||||||| ||||| ||||| ||||| || ||||| ||  || |||||  |||||| |  || |||||  || |||| || || ||||| ||||||||    
22081242 atggacatcatatgttttgcattttgagatgtacccaatttatgttggatattgagccatgcattcctaccgtcaaaggttttcttaagaacgccatgga 22081143  T
103 tgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggtctctt 202  Q
    |||||| |||||| |||| || ||||||||||| |||||||||||||| || ||||||||||||||||| |||  ||| |||| ||||||||||||||||    
22081142 tgctggttctgtgaccgctctctacttcgacgtactgctgagggcgcttgatggtatcacacctgatactgctgaactctttcatgatttctggtctctt 22081043  T
203 ttggagac 210  Q
    ||||||||    
22081042 ttggagac 22081035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0108 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0108
Description:

Target: scaffold0108; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 98 - 210
Target Start/End: Complemental strand, 39086 - 38974
Alignment:
98 atggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggt 197  Q
    ||||||||||| |||||| |||| || ||||| || ||  ||||||| ||||| ||||||||||| ||||||||||||  ||||||   ||| || ||||    
39086 atggatgctggttctgtgaccgctctttactttgatgtaatgctgagagcgcttgacggtatcactcctgataccgctgaacttttcaatgacttttggt 38987  T
198 ctcttttggagac 210  Q
    |||||||||||||    
38986 ctcttttggagac 38974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0064 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0064
Description:

Target: scaffold0064; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 98 - 210
Target Start/End: Original strand, 32652 - 32764
Alignment:
98 atggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggt 197  Q
    ||||||||||| |||||| |||| || ||||| || ||  ||||||| ||||| ||||||||||| ||||||||||||  ||||||   ||| || ||||    
32652 atggatgctggttctgtgaccgctctttactttgatgtaatgctgagagcgcttgacggtatcactcctgataccgctgaacttttcaatgacttttggt 32751  T
198 ctcttttggagac 210  Q
    |||||||||||||    
32752 ctcttttggagac 32764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0897 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0897
Description:

Target: scaffold0897; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 84 - 210
Target Start/End: Original strand, 3832 - 3958
Alignment:
84 tgctgaagaatgccatggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttt 183  Q
    |||| ||||| |||||||||||||| |||||| |||| || ||||| || ||  ||||||| ||||| ||||| ||||| ||||||||||||  ||| ||    
3832 tgcttaagaacgccatggatgctggttctgtgaccgctctttactttgatgtaatgctgagagcgctcgacggcatcactcctgataccgctgaactctt 3931  T
184 tcgtgatttctggtctcttttggagac 210  Q
       ||| || |||||||||||||||||    
3932 caatgacttttggtctcttttggagac 3958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 83 - 210
Target Start/End: Complemental strand, 74625 - 74498
Alignment:
83 ttgctgaagaatgccatggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacacttt 182  Q
    ||||| ||||| || ||||||||||| |||||| |||| || ||||| || ||  || |||| || || ||||||||||||||||||||||||  ||| |    
74625 ttgcttaagaacgctatggatgctggttctgtgaccgctctttactttgatgtaatggtgagagcacttgacggtatcacacctgataccgctgaactct 74526  T
183 ttcgtgatttctggtctcttttggagac 210  Q
    |   ||| || |||||||||||||||||    
74525 tcaatgagttttggtctcttttggagac 74498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 98 - 210
Target Start/End: Original strand, 13284375 - 13284487
Alignment:
98 atggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgatttctggt 197  Q
    ||||| ||||||||||||  ||| || ||||| || ||  ||||||||||||| ||||||||||| ||||||||| ||  ||| ||   ||| || ||||    
13284375 atggacgctggctctgtgagcgctctttactttgatgtaatgctgagggcgcttgacggtatcactcctgataccactgaactcttcaatgacttttggt 13284474  T
198 ctcttttggagac 210  Q
    |||||||||||||    
13284475 ctcttttggagac 13284487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 210
Target Start/End: Original strand, 14562226 - 14562345
Alignment:
91 gaatgccatggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgat 190  Q
    |||||| ||||| ||||||||||||  ||| || ||||| || ||  ||||||||||| | ||||||||||| |||||| || ||  ||||||   |||     
14562226 gaatgctatggacgctggctctgtgagcgctctttactttgatgtaatgctgagggcgattgacggtatcactcctgatgccactgaacttttcaatgac 14562325  T
191 ttctggtctcttttggagac 210  Q
    || |||||||||||||||||    
14562326 ttttggtctcttttggagac 14562345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0304 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0304
Description:

Target: scaffold0304; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 210
Target Start/End: Original strand, 12276 - 12395
Alignment:
91 gaatgccatggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgat 190  Q
    |||||| ||||| ||||||||||||  ||| || |||||  | ||  ||||||||||||| |||| |||||| ||||||||| ||  ||||||   |||     
12276 gaatgctatggacgctggctctgtgagcgctctttactttcatgtaatgctgagggcgcttgacgatatcactcctgataccactgaacttttcaatgac 12375  T
191 ttctggtctcttttggagac 210  Q
    || |||||||||||||||||    
12376 ttttggtctcttttggagac 12395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0304; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 91 - 210
Target Start/End: Original strand, 18027 - 18146
Alignment:
91 gaatgccatggatgctggctctgtgcccgccctatacttcgacgtgctgctgagggcgctggacggtatcacacctgataccgctacactttttcgtgat 190  Q
    |||||| ||||| ||||||||||||  ||| || |||||  | ||  ||||||||||||| |||| |||||| ||||||||| ||  ||||||   |||     
18027 gaatgctatggacgctggctctgtgagcgctctttactttcatgtaatgctgagggcgcttgacgatatcactcctgataccactgaacttttcaatgac 18126  T
191 ttctggtctcttttggagac 210  Q
    || |||||||||||||||||    
18127 ttttggtctcttttggagac 18146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University