View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6830_high_8 (Length: 237)
Name: NF6830_high_8
Description: NF6830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6830_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 103 - 215
Target Start/End: Original strand, 11880049 - 11880161
Alignment:
| Q |
103 |
tttataaatttctctccattgnnnnnnnagaggaaaaaattcatcgatctcactgcattagataaagtgtcaatacaaagctgtacttcaataaacaatt |
202 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11880049 |
tttataagtttctctccattgtttttttagaggaaaaaattcatcgatctcattgcattagataaagtgtcaatacaaagcggtacttcaataaacaatt |
11880148 |
T |
|
| Q |
203 |
gagagctagtttt |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11880149 |
gagagctagtttt |
11880161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 103 - 215
Target Start/End: Original strand, 11897465 - 11897577
Alignment:
| Q |
103 |
tttataaatttctctccattgnnnnnnnagaggaaaaaattcatcgatctcactgcattagataaagtgtcaatacaaagctgtacttcaataaacaatt |
202 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11897465 |
tttataagtttctctccattgtttttttagaggaaaaaattcatcgatctcattgcattagataaagtgtcaatacaaagcggtacttcaataaacaatt |
11897564 |
T |
|
| Q |
203 |
gagagctagtttt |
215 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11897565 |
gagagctagtttt |
11897577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 220
Target Start/End: Complemental strand, 32118626 - 32118586
Alignment:
| Q |
180 |
aagctgtacttcaataaacaattgagagctagtttttaatg |
220 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
32118626 |
aagctgtacatcaataaacaattgggagctagcttttaatg |
32118586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University