View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6830_low_4 (Length: 338)
Name: NF6830_low_4
Description: NF6830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6830_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 14074192 - 14073853
Alignment:
| Q |
1 |
taagtcattgtctttatctgattctttattgtcctctgtgacttaaacatttttcaaagttataaacacaaattaaatgagatcatatttgaaatcaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14074192 |
taagtcattgtctttatctgattctttattgtcctctgtgacttaaacatttttcaaagttataaacacaaattaaatgagatcatatttgaaatcaaaa |
14074093 |
T |
 |
| Q |
101 |
tttgaatgtttcaataacatttctatacggtgtatgttaggtgaggacatggtggtagagaagagtacatacagcgcgct-----------gt------g |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || | |
|
|
| T |
14074092 |
tttgaatgtttcaataacatttctatacggtgtatgttaggtgaggacatggtggtagagaagagtacatacagcgcatttcggaacacaggtttggaag |
14073993 |
T |
 |
| Q |
184 |
agaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggctt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14073992 |
agaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggctt |
14073893 |
T |
 |
| Q |
284 |
cagggtgtttttctccactgatgcaactgctacctctgat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14073892 |
cagggtgtttttctccactgatgcaactgctacctctgat |
14073853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 183 - 323
Target Start/End: Complemental strand, 14081469 - 14081329
Alignment:
| Q |
183 |
gagaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggct |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14081469 |
gagaagctgaaagagatgggtgtggacgaggttatagtgacgggtgtgatgactaacttgtgctgtgaaacaacggcgcgcgaggcctttattagaggct |
14081370 |
T |
 |
| Q |
283 |
tcagggtgtttttctccactgatgcaactgctacctctgat |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14081369 |
tcagggtgtttttctccactgatgcaactgctacctctgat |
14081329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 230 - 323
Target Start/End: Complemental strand, 14104893 - 14104800
Alignment:
| Q |
230 |
gatgactaacttgtgctgtgagacaacggcgcgcgaggcctttattagaggcttcagggtgtttttctccactgatgcaactgctacctctgat |
323 |
Q |
| |
|
|||||||||| | || |||||||||||||||| ||| ||||||||||||||||||||||||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
14104893 |
gatgactaacctatgttgtgagacaacggcgcatgagacctttattagaggcttcagggtgttcttctccgctgatgcaagtgctacctctgat |
14104800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 137 - 177
Target Start/End: Complemental strand, 14081532 - 14081492
Alignment:
| Q |
137 |
ttaggtgaggacatggtggtagagaagagtacatacagcgc |
177 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
14081532 |
ttaggcgaggacatggtggtggagaagagtacatacagcgc |
14081492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University