View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6831_high_6 (Length: 273)
Name: NF6831_high_6
Description: NF6831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6831_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 3055642 - 3055880
Alignment:
| Q |
18 |
caacaacattgttcataacaaagttactattagtagtagcattaaaaagaccataaacaccaccagctgaattaggtggtatttgataacctaaaggtgc |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3055642 |
caacaacatagttcataacaaagttactattagtagtagcattaaaaagaccataaacaccaccagctgaattaggtggtatttgataacctaaaggtgc |
3055741 |
T |
 |
| Q |
118 |
caagtaaaacacaaaaccgtcaccgtatgtagtgtcatttagtttatcaattgtaaaagaaaaacgtgtggtgaaacttgtgagagtgttggnnnnnnng |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3055742 |
caagtaaaacacaaaaccatcaccgtatgtagtgtcatttagtttatcaattgtaaaagaaaaacgtgtggtgaaacttgtgagagtgttggtttttttg |
3055841 |
T |
 |
| Q |
218 |
tcccataaatgtaaaggttgtgaatagaatgctcttcct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3055842 |
tcccataaatgtaaaggttgtgaatagaatgctcttcct |
3055880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University