View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6831_low_10 (Length: 295)
Name: NF6831_low_10
Description: NF6831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6831_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 7e-52; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 134 - 291
Target Start/End: Original strand, 49522337 - 49522482
Alignment:
| Q |
134 |
attgtttcagggaaacgtacgtacgtatatagcaacgagtaatcgtcagcagtgaactgaggagtctcatgaaagccttcaaagccttctagattgttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
49522337 |
attgtttcagggaaacgtacgtacgtatatagcaacgagtaatcgtcagcagtgaactgag---tctcatgaaag---------ccttctagattattct |
49522424 |
T |
|
| Q |
234 |
tgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgatattctt |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49522425 |
tgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgataatctt |
49522482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 18 - 68
Target Start/End: Original strand, 49522220 - 49522270
Alignment:
| Q |
18 |
catggaatagtcatgaggaagcttttgactgcacatacggtagatggttct |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49522220 |
catggaatagtcatgaggaagcttttgactgcacatacggtagatggttct |
49522270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 286
Target Start/End: Original strand, 49532746 - 49532818
Alignment:
| Q |
214 |
aaagccttctagattgttcttgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgata |
286 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||| || | ||| |||| || |||||||| ||||||||||||| |
|
|
| T |
49532746 |
aaagccttctagaatgttctggagcttcttgattcccttctgcataatactccatccttgttcaaagttgata |
49532818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University