View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6831_low_15 (Length: 225)
Name: NF6831_low_15
Description: NF6831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6831_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 10 - 219
Target Start/End: Original strand, 8335900 - 8336103
Alignment:
| Q |
10 |
ttataactgtgcatgcaatggaagaactactatgtaccattgttcatccaccttatagtttaacatattatttgctcctattctcaaattgattgcacta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8335900 |
ttataactgtgcatgcaatggaagaactactatgtaccattgttcatccaccttatagtttaacatatt---tgctcctattctcaaattgattgcacta |
8335996 |
T |
 |
| Q |
110 |
aattatattgaccttacattcataatttgatggggtcaactgagtgaaaatgctacaaaacaataatattcattccattttgcttctcaggggaccaaaa |
209 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8335997 |
aattatattgaccttacattcat---ttgatggggtcaactgagtgaaaatgctacaaaacaataatattcattccattttgcttctcaggggaccaaaa |
8336093 |
T |
 |
| Q |
210 |
gcgaccaaca |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
8336094 |
gcgaccaaca |
8336103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University