View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6834_high_3 (Length: 346)
Name: NF6834_high_3
Description: NF6834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6834_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 48 - 312
Target Start/End: Complemental strand, 53830186 - 53829921
Alignment:
| Q |
48 |
actaattaggctaagcattt-acatatatgttgttattactggatataggactggccagtgatgtctatatcacgatccccagatgaaggaggaggatta |
146 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53830186 |
actaattaggctaagtattttacatatatgttgttattactggatataggactggccagtgatgtctatatcacgatccccagatgaaggaggaggatta |
53830087 |
T |
 |
| Q |
147 |
tgtttgggcttgatagtgtccttatcaacaggtccatcagcactttgagtctcacttgctggttgtttggtttgtttttctggttgccctttttctgtgc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53830086 |
tgtttgggcttgatagtgtccttatcaacaggaccatcagcactttgagtctcacttgctggttgtttggtttgtttttctggttgccctttttctgtgc |
53829987 |
T |
 |
| Q |
247 |
catacattccaccaccataagcgccatgtgtgactggctccatcgttgagatttgatgtccatctc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
53829986 |
catacattccaccaccataagcgccatgtgtgactggctccatcgttgagatttgaggtccttctc |
53829921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University