View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6835_low_4 (Length: 244)
Name: NF6835_low_4
Description: NF6835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6835_low_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 14 - 244
Target Start/End: Complemental strand, 5957731 - 5957501
Alignment:
| Q |
14 |
atcaaggtctcctttaactgccaaccctgtggcatcttcaagtgtaaaaccctgataaagtggaaaagaaaaatcagttggagaagaatgtaaacacaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5957731 |
atcaaggtctcctttaactgccaaccctgtggcatcttcaagtgtaaaaccctgataaagtggaaaagaaaaatcagttggaaaagaatgtaaacacaga |
5957632 |
T |
 |
| Q |
114 |
agcatggaaattataatggcaattaaatccaattattaatcgagtttaagccaaatgaggcccttcgacacgtgttacatatcactatcattattaattg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5957631 |
agcatggaaattataatggcaattaaatccaattattaatcgagtttaagccaaatgaggcccttcgacacgtgttacatatcactatcattattaattg |
5957532 |
T |
 |
| Q |
214 |
taaaatggctttggaggtacatgtacatccc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5957531 |
taaaatggctttggaggtacatgtacatccc |
5957501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University