View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6838_high_1 (Length: 334)
Name: NF6838_high_1
Description: NF6838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6838_high_1 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 17 - 334
Target Start/End: Original strand, 19419250 - 19419567
Alignment:
| Q |
17 |
atcaagaaacgccgccataactgaacaacctctcgatctcaaaacaccgctagcttccttgaatggaaacgttgacgaatccgtgattaaccgtttcgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419250 |
atcaagaaacgccgccataactgaacaacctctcgatctcaaaacaccgctagcttccttgaatggaaacgttgacgaatccgtgattaaccgtttcgat |
19419349 |
T |
|
| Q |
117 |
ccaaaaccgccgtcgccggagatttttcttgatgaaaaacaacttgctccggaaggacgaggaagctgaaaataaggatcaaagaagctttccgtttgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419350 |
ccaaaaccgccgtcgccggagatttttcttgatgaaaaacaacttgctccggaaggacgaggaagctgaaaataaggatcaaagaagctttccgtttgaa |
19419449 |
T |
|
| Q |
217 |
aaataacgagataaccgtcatcgagcaacggcgttggattaaccgttacgttgttgatggagagtttacggtcggaagtagttgtgacggtgagggagtg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419450 |
aaataacgagataaccgtcatcgagcaacggcgttggattaaccgttacgttgttgatggagagtttacggtcggaagtagttgtgacggtgagggagtg |
19419549 |
T |
|
| Q |
317 |
accggggagaagagtagc |
334 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
19419550 |
accggggagaagagtagc |
19419567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 234
Target Start/End: Complemental strand, 27969510 - 27969444
Alignment:
| Q |
168 |
gaaggacgaggaagctgaaaataaggatcaaagaagctttccgtttgaaaaataacgagataaccgt |
234 |
Q |
| |
|
|||||||||||||||| || ||||||||| ||||||||||| ||| ||||||| |||||||||| |
|
|
| T |
27969510 |
gaaggacgaggaagctaaacataaggatctaagaagctttcaatttagaaaataattagataaccgt |
27969444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University