View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6838_low_6 (Length: 236)

Name: NF6838_low_6
Description: NF6838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6838_low_6
NF6838_low_6
[»] chr5 (1 HSPs)
chr5 (105-220)||(19419686-19419801)


Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 105 - 220
Target Start/End: Complemental strand, 19419801 - 19419686
Alignment:
105 gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19419801 gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc 19419702  T
205 taaccctcttccctcc 220  Q
    ||||| ||||| ||||    
19419701 taaccatcttcgctcc 19419686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University