View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6838_low_6 (Length: 236)
Name: NF6838_low_6
Description: NF6838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6838_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 105 - 220
Target Start/End: Complemental strand, 19419801 - 19419686
Alignment:
| Q |
105 |
gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419801 |
gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc |
19419702 |
T |
 |
| Q |
205 |
taaccctcttccctcc |
220 |
Q |
| |
|
||||| ||||| |||| |
|
|
| T |
19419701 |
taaccatcttcgctcc |
19419686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University