View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6840_low_5 (Length: 284)
Name: NF6840_low_5
Description: NF6840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6840_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 36 - 226
Target Start/End: Complemental strand, 963335 - 963146
Alignment:
| Q |
36 |
agaacctgtgtttgggagagactctaagtcctaaaacataagctagttttacataagctgaattccctcttgtaactgttttcacacaaccccttatcac |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
963335 |
agaacctgtgtttgggagagactctaagtcctaaaacataagctagttttacataagctgaattccctcttgtaactgttttcacacaaccccttatcac |
963236 |
T |
|
| Q |
136 |
tccaacaacttctccttcttctccatattctgcaacctgtttggaacaaatattaccttgatcagtccatatatcaaactgtgaaactact |
226 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
963235 |
tccagcaacttctccttcttcttcatattctgcaacctgtttggaacaaatattacattgattagtcca-atatcaaactgtgaaactact |
963146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 235 - 265
Target Start/End: Complemental strand, 963056 - 963026
Alignment:
| Q |
235 |
tattcaacactaaaacataatgtcgcattag |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
963056 |
tattcaacactaaaacataatgtcgcattag |
963026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University