View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6843_high_1 (Length: 498)
Name: NF6843_high_1
Description: NF6843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6843_high_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 1 - 492
Target Start/End: Complemental strand, 44776826 - 44776332
Alignment:
| Q |
1 |
tttgcagtgaagtttaaatcaaagcatcttagaaaggacggccatttacaattagggaggtgaaggcttcaaacattggtcagctagtcaggatagctgg |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44776826 |
tttgcagtgaagtttatatcaaagcatcttcgaaaggacggccatttacaattagggaggtgaaggcttcaaacattggtcagctagtgaggatagctgg |
44776727 |
T |
|
| Q |
101 |
tatcgttacacgtt-ctcagatgtcaaaccattgatgcaggtggctgtgtacacctgtgaggattgtggctttgaaatctatcaggtaattcatataagt |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44776726 |
tatcgttacacgttgctcagatgtcaaaccattgatgcaggtggctgtgtacacctgtgaggattgtggctttgaaatctatcaggtaattcatataagt |
44776627 |
T |
|
| Q |
200 |
actgcatta-tttatctagatgcacaataaggtttaaaatagaaatggagggttcttttctgctatttttatttggttgccaggatgtcaatcaacaatg |
298 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44776626 |
actgcattactttatccagatgcacaataaggtttaaaatagaaatggagggttcttttctgctatttttatttggttgccaggatgtcaatcaacaatg |
44776527 |
T |
|
| Q |
299 |
ttaaccattactataatttatttataactatttatcaaaccttgttagatttgttttggactannnnnnncctcttttgtaggctgaattgttttggagt |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44776526 |
ttaaccattactataatttatttataactatttatcaaaccttgttagatttgttttggactatttttttcctcttttgtaggctgaattgttttggagt |
44776427 |
T |
|
| Q |
399 |
tcacgtcccctaagatttttaactttgttgttttcttccctccctatacaggaagtaacagctagagtattcatgcctttgtttga-tgtccatc |
492 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44776426 |
tcacgtcccctaagatttttaactatgttgttttcttccctccctatacaggaagtaacagctagagtattcatgcctttgtttgagtgtccatc |
44776332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University