View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6843_low_6 (Length: 240)
Name: NF6843_low_6
Description: NF6843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6843_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 37052732 - 37052509
Alignment:
| Q |
1 |
tcttggttcatcaatagcatcagaatgattagcaggcaatccaagctccataaattgtctcggaaccaaaactccaccattcccattttgtttctcctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37052732 |
tcttggttcatcaatagcatcagaatgattagcaggcaatccaagctccataaattgtctcggaaccaaaactccaccattcccattttgtttctcctca |
37052633 |
T |
 |
| Q |
101 |
tcaagttttccacccatcacttgtttttgctcttcattacaatcctctaccttcttgtcttgcaccatactcatccaatgcatctgcaatgtgttatact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37052632 |
tcaagttttccacccatcacttgtttttgctcttcattacaatcctctaccttcttgtcttgcaccatactcatccaatgcatctgcaatgtgttgtact |
37052533 |
T |
 |
| Q |
201 |
tcctattaccctcatcaagcatgt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37052532 |
tcctattaccctcatcaagcatgt |
37052509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University