View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6844_high_7 (Length: 408)
Name: NF6844_high_7
Description: NF6844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6844_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 400
Target Start/End: Original strand, 29640586 - 29640960
Alignment:
| Q |
18 |
caacatgtgtgccaaaaaagttgtttctattaaccttcagcaaaatgagatgctatgaatggatcatacccctttttgcattttagatct---aatcata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
29640586 |
caacatgtgtgccaaaaaagttgtttctattaaccttcagcaaaatgagatgctatgaatggatcataccccgctttgcattttagatctttaaatcata |
29640685 |
T |
 |
| Q |
115 |
ataagttagaatttactgaaaaatagtaatctcacttcctatatgatgcaggtcttttaatttttaannnnnnnnnnnnatacaaacaaaccaaggaaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29640686 |
ataagttagaatttactgaaaaatagtaatctcacttcctat---atgcaggtcttttaattttt------ttttttttatacaaactaaccaaggaaat |
29640776 |
T |
 |
| Q |
215 |
ggattttccaagcatcttagtatcattgttctttgtcaaggcttctcttcacgttgttgtgnnnnnnnngttgttgttgaatatcccttgatgcgtcatc |
314 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| ||||| |
|
|
| T |
29640777 |
ggattttctaagcatcttagtatcattgttctttgtcaaggcttctcttcacgttgttgtgtttttt---tttttgttgaatatcccttgatgcctcatc |
29640873 |
T |
 |
| Q |
315 |
atactgcaaataca-ttagtatctttatgatcatttggctcatgttggtgcccctgtttctaacaaacgtatggttcttcagttcat |
400 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29640874 |
atactgcaaatacatttagtatctttatgatcatttgtctcatgttggtgcccctgtttctaacaaacgtatggttcttcagctcat |
29640960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 304 - 394
Target Start/End: Original strand, 55155124 - 55155215
Alignment:
| Q |
304 |
gatgcgtcatcatactgcaaatacatta-gtatctttatgatcatttggctcatgttggtgcccctgtttctaacaaacgtatggttcttca |
394 |
Q |
| |
|
||||| |||||||||||| || |||||| || ||||| |||||| ||| || |||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
55155124 |
gatgcctcatcatactgccaacacattaagtctctttctgatcaattgtctaatgttggtgcacctgtttccaacgaacgtatggttcttca |
55155215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University