View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6844_high_9 (Length: 351)
Name: NF6844_high_9
Description: NF6844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6844_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 6917452 - 6917112
Alignment:
| Q |
1 |
tacctgtttcctgttgcagaactggtgtgtgttctcgttgggctcaactgttgccgggaacgaacacggcttcagat-aattcttgggcgg--tctcctg |
97 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
6917452 |
tacctgttccctgttgcagaactggtgtgtgttctcgttgggctcaactgttgccgggaacgaacacggcttcagatcaattcttgggcggcctctcctg |
6917353 |
T |
 |
| Q |
98 |
ggcggctaggcttccacgagcacagcacagctcaaactgattgccagatacgggagcggactcgtctcaaactgctgcggcttcaggatcaatctctgag |
197 |
Q |
| |
|
|| ||||| ||||||||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917352 |
ggtggctacgcttccacgagcatggcacagctcaaactgtttgccagatacgggagcagactcgtctcaaactgctgcggcttcaggatcaatctctgag |
6917253 |
T |
 |
| Q |
198 |
cgtgtccatgggaaactcggggtgctgtcaatgg-------cgagctttgactaatgaaggcggttcaacggagacttcactgtcgccgccgtgaatgat |
290 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6917252 |
cgtgtctgtgggaaactcggcgtgctgtcaatggcgctgctcgagctttgactaatgaaggcggtttggcggagacttcactgtcgccgccgtgaatgat |
6917153 |
T |
 |
| Q |
291 |
gctaaactgaattttcttccaacagttcttctgcctattga |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917152 |
gctaaactgaattttcttccaacagttcttctgcctattga |
6917112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University