View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6845_high_14 (Length: 229)
Name: NF6845_high_14
Description: NF6845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6845_high_14 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 6227603 - 6227815
Alignment:
| Q |
18 |
actatggatccttatgtacttttttgacaacagaaatttatctttt-aagttcagtttattcctttatgttttgaagattcctatttcataccatatatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
6227603 |
actatggatccttatgtacttttttgacaacagaaatttatctttttaagttcagtttattcctttatgttttgaagattcctatttcctaacatatatg |
6227702 |
T |
|
| Q |
117 |
gaaagttcaaacatgtccaatgaagtatatattaggagtgtggttataagcattattacttattgattgtaaactcaaaactcttctgataagtctctaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6227703 |
gaaagttcaaacatgtccaatgaagtatatattaggagtgtggttataagcattattacttattgattgtaaactcaaaactcttctgataagtctctga |
6227802 |
T |
|
| Q |
217 |
aatcattatttct |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6227803 |
aatcattatttct |
6227815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 74 - 129
Target Start/End: Original strand, 6223087 - 6223142
Alignment:
| Q |
74 |
tattcctttatgttttgaagattcctatttcataccatatatggaaagttcaaaca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
6223087 |
tattcctttatgttttgaagattcctatttcctaccatatatggaaaggtcaaaca |
6223142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University