View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6845_low_22 (Length: 213)
Name: NF6845_low_22
Description: NF6845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6845_low_22 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 8756602 - 8756390
Alignment:
| Q |
1 |
caaccccgccttcttcaattataagcttcccgtatcggtcactgcctcgtgccaatgacacaagcgaagcagctgcatcagaacgaacttcttgtgaacc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756602 |
caaccccaccttcttcaattataagcttcccgtatcggtcactgcctcgtgccaatgacacaagcgaagcagctgcatcagaacgaacttcttgtgaacc |
8756503 |
T |
 |
| Q |
101 |
ggtgaataacatagcgatctgctcccatataaaacataatataggttcattggctgctattggtggaagtccaagatactcgccaccgcgatcatcagcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756502 |
ggtgaataacatagcgatctgctcccatataaaacataatataggttcattggctgctattggtggaagtccaagatactcgccaccgcgatcatcagcg |
8756403 |
T |
 |
| Q |
201 |
ggggcagatactc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8756402 |
ggggcagatactc |
8756390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University