View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6846_high_4 (Length: 231)
Name: NF6846_high_4
Description: NF6846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6846_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 20490747 - 20490543
Alignment:
| Q |
16 |
acatcaccaacctcacctccccttcacatccaaaaaactaccgcatcgatgtagacacttgttgttatggtgcaatgtctttcatgactgcaccaccgtt |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20490747 |
acatcaccaacctcacctcctcttcacatccaaaaaactaccgcatcgatgtagatgcttgctgttatggtgcaatgtctttcatgactgcaccaccgtt |
20490648 |
T |
|
| Q |
116 |
ctcccctttgtccttcgattatcctccatccaacgtctctcccctattctgttgtcgttttcgtcggtttgcaagtttgttgttgtgttggttacgatga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
20490647 |
ctcccctttgtccttcgattatcctccatccaacgtctctcccctcttccgttgtcgttttcgtcggtttgcaagtttgttgttgtgttggttacggtgt |
20490548 |
T |
|
| Q |
216 |
tgtcc |
220 |
Q |
| |
|
||||| |
|
|
| T |
20490547 |
tgtcc |
20490543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 42237357 - 42237249
Alignment:
| Q |
16 |
acatcaccaacctcacctccccttcacatccaaaaaactaccgcatcgatgtagacacttgttgttatggtgcaatgtctttcatgactgcaccaccgtt |
115 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| ||| ||||||| |||||||| |||||||| |||||| ||| |||||||| | ||| ||||||| |
|
|
| T |
42237357 |
acatcaccgtcctctcctccccttcacatccaaacaacaaccgcatagatgtagatgcttgttgtggtggtgcgatgcctttcatggcagcatcaccgtt |
42237258 |
T |
|
| Q |
116 |
ctccccttt |
124 |
Q |
| |
|
||||||||| |
|
|
| T |
42237257 |
ctccccttt |
42237249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 16 - 124
Target Start/End: Complemental strand, 32865368 - 32865260
Alignment:
| Q |
16 |
acatcaccaacctcacctccccttcacatccaaaaaactaccgcatcgatgtagacacttgttgttatggtgcaatgtctttcatgactgcaccaccgtt |
115 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| ||| |||||||||||||||| |||| ||| |||||| ||| |||||||| | ||| |||||| |
|
|
| T |
32865368 |
acatcaccgtcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgcgatgcctttcatggccgcattaccgtt |
32865269 |
T |
|
| Q |
116 |
ctccccttt |
124 |
Q |
| |
|
||||||||| |
|
|
| T |
32865268 |
ctccccttt |
32865260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 16 - 124
Target Start/End: Original strand, 35246844 - 35246952
Alignment:
| Q |
16 |
acatcaccaacctcacctccccttcacatccaaaaaactaccgcatcgatgtagacacttgttgttatggtgcaatgtctttcatgactgcaccaccgtt |
115 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| ||| |||||||||||||||| |||| ||| ||||| ||| |||||||| | ||| ||| ||| |
|
|
| T |
35246844 |
acatcaccctcctctcctccccttcacatccaaacaacaaccgcatcgatgtagatgcttgctgtggtggtgtgatgcctttcatggccgcatcactgtt |
35246943 |
T |
|
| Q |
116 |
ctccccttt |
124 |
Q |
| |
|
||||||||| |
|
|
| T |
35246944 |
ctccccttt |
35246952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 101
Target Start/End: Original strand, 21747258 - 21747343
Alignment:
| Q |
16 |
acatcaccaacctcacctccccttcacatccaaaaaactaccgcatcgatgtagacacttgttgttatggtgcaatgtctttcatg |
101 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||| ||| ||| |||||||||||| |||| ||| |||||| ||| |||||||| |
|
|
| T |
21747258 |
acatcaccgtcctctcctccccttcacatccaaacaacaaccacatcgatgtagatgcttgctgtggtggtgcgatgcctttcatg |
21747343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University