View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6846_low_5 (Length: 331)

Name: NF6846_low_5
Description: NF6846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6846_low_5
NF6846_low_5
[»] chr5 (3 HSPs)
chr5 (185-318)||(9436959-9437092)
chr5 (16-112)||(9437165-9437261)
chr5 (16-80)||(33758579-33758643)
[»] chr7 (3 HSPs)
chr7 (197-318)||(15118245-15118366)
chr7 (16-80)||(15118069-15118133)
chr7 (16-72)||(10004338-10004394)
[»] chr2 (2 HSPs)
chr2 (220-318)||(5051932-5052030)
chr2 (26-66)||(7694668-7694708)
[»] chr4 (3 HSPs)
chr4 (16-109)||(50590359-50590452)
chr4 (16-79)||(51406907-51406970)
chr4 (210-273)||(50590200-50590263)
[»] chr3 (1 HSPs)
chr3 (16-77)||(51056070-51056131)


Alignment Details
Target: chr5 (Bit Score: 118; Significance: 4e-60; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 185 - 318
Target Start/End: Complemental strand, 9437092 - 9436959
Alignment:
Q  185 gcagatctgtaaatcctttgtgtgagtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggat 284  Q
    |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  9437092 gcagatatgtaaatcctttgtgtgagtttggttttgggtggtcgtagaccgccgacggcctttggtgtagttccaaggtggcggtggtttggtggtggat 9436993  T
Q  285 atgggttgtacaacaccctttctcggtggtgatg 318  Q
    |||||||| |||||||||||||||||||||||||    
T  9436992 atgggttgcacaacaccctttctcggtggtgatg 9436959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 16 - 112
Target Start/End: Complemental strand, 9437261 - 9437165
Alignment:
Q  16 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccaaaggttgctgcatcggtgaactgtggttatt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||    
T  9437261 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccgaaggttgctgcatcggtggactgtggttatt 9437165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 33758643 - 33758579
Alignment:
Q  16 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctccc 80  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||    
T  33758643 gacatcagttggtggtggtgcgacggtcggctttagccatccgcaccatcctttccagatctccc 33758579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 70; Significance: 2e-31; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 197 - 318
Target Start/End: Original strand, 15118245 - 15118366
Alignment:
Q  197 atcctttgtgtgagtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggatatgggttgtaca 296  Q
    ||||| |||| | |||||||||||||||||| |||||||| | | |||||||||||| ||||||||||||||||||| ||||||||||||||||||  ||    
T  15118245 atcctctgtgagtgtttggttttgggtggtcgtagaccgctggcagcctttggtgtaattccaaggtggcggtggtttggtggtggatatgggttgcgca 15118344  T
Q  297 acaccctttctcggtggtgatg 318  Q
    ||||| ||||||||| ||||||    
T  15118345 acaccatttctcggtagtgatg 15118366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 80
Target Start/End: Original strand, 15118069 - 15118133
Alignment:
Q  16 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctccc 80  Q
    ||||||| |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||    
T  15118069 gacatcacttggtggtggtgtgacggtcgggtttagccatccgcaccaccctttccagatctccc 15118133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 10004394 - 10004338
Alignment:
Q  16 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttcta 72  Q
    |||| |||||| |||||||| ||||  ||||||||||||||| ||||||||||||||    
T  10004394 gacaacagttgatggtggtgcgacgaacggctttagccatccacaccaccctttcta 10004338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 220 - 318
Target Start/End: Complemental strand, 5052030 - 5051932
Alignment:
Q  220 gggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggttcggtggtggatatgggttgtacaacaccctttctcggtggtgatg 318  Q
    |||||||| |||||||||  ||||||||||| || ||||||| ||||||||||| |||||| |||||||||||  ||||||||||||||||||||||||    
T  5052030 gggtggtcgtagaccgccagcggcctttggtataattccaagatggcggtggtttggtggttgatatgggttgcgcaacaccctttctcggtggtgatg 5051932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 7694668 - 7694708
Alignment:
Q  26 ggtggtggtgtgacggtcggctttagccatccgcaccaccc 66  Q
    |||||||||| |||||||| |||||||||||||||||||||    
T  7694668 ggtggtggtgcgacggtcgactttagccatccgcaccaccc 7694708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 16 - 109
Target Start/End: Complemental strand, 50590452 - 50590359
Alignment:
Q  16 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcccaaaggttgctgcatcggtgaactgtggtt 109  Q
    |||||||| ||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||  ||||||  || |||||| |||||||||    
T  50590452 gacatcaggtggtggtggtgcgacggtcggctttagccatccgcaccacactttccagatctcccggaggttgtcgcgtcggtggactgtggtt 50590359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 16 - 79
Target Start/End: Original strand, 51406907 - 51406970
Alignment:
Q  16 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatctcc 79  Q
    |||||||| ||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||    
T  51406907 gacatcagatggtggtggtgcgacggtcggctttagccatccgcaccatcctttccagatctcc 51406970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 210 - 273
Target Start/End: Complemental strand, 50590263 - 50590200
Alignment:
Q  210 gtttggttttgggtggtcatagaccgccgacggcctttggtgtagttccaaggtggcggtggtt 273  Q
    |||||||||||||||||| |||||||||| |||||||||||||| ||||||||| |||| ||||    
T  50590263 gtttggttttgggtggtcgtagaccgccggcggcctttggtgtaattccaaggtagcggcggtt 50590200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 77
Target Start/End: Original strand, 51056070 - 51056131
Alignment:
Q  16 gacatcagttggtggtggtgtgacggtcggctttagccatccgcaccaccctttctagatct 77  Q
    |||||||||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||    
T  51056070 gacatcagttggtggtggtgcgacggtcggctttagccatccacaccaccctttccagatct 51056131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University