View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6847_low_5 (Length: 237)
Name: NF6847_low_5
Description: NF6847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6847_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 50782820 - 50782615
Alignment:
| Q |
13 |
tttggtgttggataatagatatttatcatatactttgttgatatctctttggttttt-atcaaggtcggttcaataattttcaatagtgaggcctaaaca |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50782820 |
tttggtattggataatagatatttatcatatactttgttgatatctctttggttttttatcaaggtcggttcaataattttcaatagtgaggcctaaaca |
50782721 |
T |
|
| Q |
112 |
aatttaaatatatatggcctttttgttggtatataaagcnnnnnnnnacttataaaatctaataaaaaataacttttttgttgataggtctaaagctaga |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
50782720 |
aatttaaatatatatggcctttttgttggtatataaagc-tttttttacttagaaaatctaataaaaaataac-tttttgttgataggtctaaagctaga |
50782623 |
T |
|
| Q |
212 |
actctagt |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
50782622 |
actctagt |
50782615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 194
Target Start/End: Original strand, 8374610 - 8374640
Alignment:
| Q |
164 |
taaaatctaataaaaaataacttttttgttg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8374610 |
taaaatctaataaaaaataacttttttgttg |
8374640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University