View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6848_high_2 (Length: 408)
Name: NF6848_high_2
Description: NF6848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6848_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 200 - 387
Target Start/End: Complemental strand, 48651863 - 48651676
Alignment:
| Q |
200 |
tctcaaaaactcaaaatacctaaacttttttgttactttcttcaattgaaacgcaacnnnnnnnctgtttattcaatcacatccgatggtatgttacttt |
299 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48651863 |
tctcaaaaagtcaaaatacctaaacttctttgttactttcttcaattgaaacgcaacaaaaaaactgtttattcaatcacatccgctggtatgttacttt |
48651764 |
T |
 |
| Q |
300 |
gatttgtgaattaaagtttaatttagtcttggttttgattttggattttgtgcctgaaaatttaggggggtttgagctttttgaatat |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48651763 |
gatttgtgaattaaagtttaatttagtcttggttttgattttggattttgtgcctgaaaatttaggggggtttgagctttttgaatat |
48651676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 23 - 154
Target Start/End: Complemental strand, 48651992 - 48651861
Alignment:
| Q |
23 |
cacattttttgcaatttggtttcaagtccgtacgcgggctcgttagattgtgcaagtggtgcatggacgttgttgttttcttcagatcaggattgtggct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48651992 |
cacattttttgcaatttggtttcaagtccgtacgcgggctcgttagattgtgcaagtggtgcatggacgttgttgttttcttcagatcaggattgtggct |
48651893 |
T |
 |
| Q |
123 |
tccttactcattagggatgttgtgtattatct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48651892 |
tccttactcattagggatgttgtgtattatct |
48651861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 19481594 - 19481642
Alignment:
| Q |
35 |
aatttggtttcaagtccgtacgcgggctcgttagattgtgcaagtggtg |
83 |
Q |
| |
|
|||||||||||| ||||||| | || |||||| |||||||||||||||| |
|
|
| T |
19481594 |
aatttggtttcatgtccgtatgtggactcgttggattgtgcaagtggtg |
19481642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 27 - 59
Target Start/End: Original strand, 41322148 - 41322180
Alignment:
| Q |
27 |
ttttttgcaatttggtttcaagtccgtacgcgg |
59 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
41322148 |
ttttttgtaatttggtttcaagtccgtacgcgg |
41322180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University