View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6848_high_4 (Length: 242)
Name: NF6848_high_4
Description: NF6848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6848_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 23 - 202
Target Start/End: Original strand, 35837270 - 35837452
Alignment:
| Q |
23 |
ctttaatttggttccagtaattaaacaagcccttcaattttt-agcattaaaactggtttctttgnnnnnnn-agtttaactgacaatgtggtactgttg |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35837270 |
cttttatttggttccagtaattaaacaagcccttcaattttttagcattaaaactggtttctttgttttttttagtttaactgacaatgtggtactgttg |
35837369 |
T |
 |
| Q |
121 |
gnnnnnnnctctccacatttggtt-agttggttgttttgatttctgaataagtgattatcgtttaactgacttaaaaaagttg |
202 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35837370 |
gtttttttctctccacatttggtttagttggttgttttgatttctgaataagtgattatcttttaactgacttaaaaaagttg |
35837452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University