View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6848_low_5 (Length: 243)
Name: NF6848_low_5
Description: NF6848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6848_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 37807544 - 37807767
Alignment:
| Q |
1 |
tgcttcaatagctttcttgacagagccgtaggcatagtgaagcatgacaactgaatctcctttattgaattttccttcttggaaagcccacgatgcttgc |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37807544 |
tgcttcaatggctttcttgacagagccgtaggcatagtgaagcatgacaactgaatctcctttattgaattttccttcttggaaagcccacgatgcttgc |
37807643 |
T |
 |
| Q |
101 |
tggagaacaattgcggtggcagtggaggcgttatcaacgatggagatttcattaacatgttgagcgttgacgagatctttgatgatggttcgggaatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37807644 |
tggagaacaattgcggtggcagtggaggcgttatcaacgatggagatttcattaacatgttgagcgttgacgagatctttgatgatggttcgggaatgga |
37807743 |
T |
 |
| Q |
201 |
ggattcctttttggaggtggttga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37807744 |
ggattcctttttggaggtggttga |
37807767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University