View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6848_low_6 (Length: 242)

Name: NF6848_low_6
Description: NF6848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6848_low_6
NF6848_low_6
[»] chr4 (1 HSPs)
chr4 (23-202)||(35837270-35837452)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 23 - 202
Target Start/End: Original strand, 35837270 - 35837452
Alignment:
23 ctttaatttggttccagtaattaaacaagcccttcaattttt-agcattaaaactggtttctttgnnnnnnn-agtttaactgacaatgtggtactgttg 120  Q
    |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||        |||||||||||||||||||||||||||    
35837270 cttttatttggttccagtaattaaacaagcccttcaattttttagcattaaaactggtttctttgttttttttagtttaactgacaatgtggtactgttg 35837369  T
121 gnnnnnnnctctccacatttggtt-agttggttgttttgatttctgaataagtgattatcgtttaactgacttaaaaaagttg 202  Q
    |       |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
35837370 gtttttttctctccacatttggtttagttggttgttttgatttctgaataagtgattatcttttaactgacttaaaaaagttg 35837452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University