View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6849_high_5 (Length: 296)
Name: NF6849_high_5
Description: NF6849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6849_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 18 - 289
Target Start/End: Complemental strand, 20361985 - 20361720
Alignment:
| Q |
18 |
atatgtacggtaaaatgaaaagatgggtatgttgttatgattactaaccataaccataaccataaccatggcggggtgtattaggttttaatgagaaact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20361985 |
atatgtacggtaaaatgaaaagatgggtatgttgttatgattactaaccataaccataaccat------ggcggggtgtattaggttttaatgagaaact |
20361892 |
T |
|
| Q |
118 |
ttttgacatcaacatcaacaacatcaacaccaggatcttgaacaacatgagtctggaaagttgttagatcaggttttcctttctgtgttgcttgaaaagt |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
20361891 |
ttttgacatcaacatcaacaatatcaacaccaggatcttgaacaacatgagtctggaaagttgttagatcaggttttcctttatctgttgcttgaaaagt |
20361792 |
T |
|
| Q |
218 |
aatgtaatacaccctaccagcagttaaatcagtagcagcaggatgggtacacttgacaacattatgaaacac |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20361791 |
aatgtaatacaccctaccagcagttaaatcagtagcagcaggatgggtacacttgacaacattatgaaacac |
20361720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 21549793 - 21549737
Alignment:
| Q |
18 |
atatgtacggtaaaatgaaaagatgggtatgttgttatgattactaaccataaccat |
74 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21549793 |
atatgtatggtaaaatgaaaagatggatatgttgttatgattactaaccataaccat |
21549737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 205 - 289
Target Start/End: Complemental strand, 21549606 - 21549522
Alignment:
| Q |
205 |
ttgcttgaaaagtaatgtaatacaccctaccagcagttaaatcagtagcagcaggatgggtacacttgacaacattatgaaacac |
289 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||| |||| ||||||| |||||||||||||||||||||| |||| |||||| |
|
|
| T |
21549606 |
ttgctttaaaagtaatgtaatataccctaggagcatataaagaagtagcaccaggatgggtacacttgacaactttatcaaacac |
21549522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University