View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6851_low_14 (Length: 253)
Name: NF6851_low_14
Description: NF6851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6851_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 35 - 235
Target Start/End: Complemental strand, 9535791 - 9535591
Alignment:
| Q |
35 |
caggtgcaggtgctgcttggatttccttagtgatatgaccactaccaccagcagaggaccctgcggttgattcaatcgatctattcagatcgaacacaag |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9535791 |
caggtgcaggtgctgcttggatttccttagtgatatgaccactaccaccagcagaggaccctgcggttgattcgatcgatctattcagatcgaacacaag |
9535692 |
T |
|
| Q |
135 |
ctcgcgagctaatgagctcaccccttcattgatcttgtcgccaagaccatcacctgtaaacaattaaccacataacaaataaagcacacaatcatatata |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9535691 |
ctcgcgagctaatgagctcaccccttcattgattttgtcgccaagaccatcacctgtaaacaattaaccacataacaaataaagcacacaatcatatata |
9535592 |
T |
|
| Q |
235 |
t |
235 |
Q |
| |
|
| |
|
|
| T |
9535591 |
t |
9535591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University