View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6851_low_15 (Length: 204)
Name: NF6851_low_15
Description: NF6851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6851_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 9 - 185
Target Start/End: Complemental strand, 47377889 - 47377713
Alignment:
| Q |
9 |
gtttggtgtttggtgaagaaccgggaactgaaaccgatcgatttgattcctggcggatcaatgaagatcattagagaaactccgacgtcggcgttcgtga |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47377889 |
gtttgttgtttggtgaagaaccgggaactgaacccgatcgatttgattcctggcggatcaatgaagatcattagagaaactccgacgtcggcgttcgtga |
47377790 |
T |
|
| Q |
109 |
ggtttaaagccgggagcgtcgagccggcacatcatcatacctttggacatgatttagtggtgattgaagggaagaag |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47377789 |
ggtttaaagccgggagcgtcgagccggcacatcatcatacctttggacatgatttagtggtgattgaagggaagaag |
47377713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University