View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6851_low_9 (Length: 337)
Name: NF6851_low_9
Description: NF6851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6851_low_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 19 - 337
Target Start/End: Original strand, 50008369 - 50008687
Alignment:
| Q |
19 |
gcatttccctcctagcttgaagtttctttgaaatctatgtagttgtctatcattcatgaaaatttcagcttttgtgctgagaatggtgcgcaactatatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50008369 |
gcatttccctcctagcttgaagtttctttgaaatctatgtagttgtctatcattcatgaaaatttcagcttttgtgctgagaatggtgcgcaactatatg |
50008468 |
T |
 |
| Q |
119 |
gtggttgcccatggtgcacctgcatcgagccattcaaccctacaacttatactctggaccgtgcaaagtgcaaacaaacagttgaatagacattttcaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50008469 |
gtggttgcccatggtgcacctgcatcgagccattcaaccctacaacttatactctggaccgtgcaaagtgcaaacaaacagttgaatagacattttcaaa |
50008568 |
T |
 |
| Q |
219 |
tcgatgtaagatgatattctggtacggaatcattattttcagatgccacatcataaacaaggtgcaaatgaatgttactaatgaagacttgtttgtatca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50008569 |
tcgatgtaagatgatattctggtacggaatcattattttcagatgccacatcataaacaaggtgcaaatgaatgttactaatgaagacttgtttgtatca |
50008668 |
T |
 |
| Q |
319 |
atctgtgtccaccctcctc |
337 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
50008669 |
atctgtgtcaaccctcctc |
50008687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University