View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6853_high_3 (Length: 393)
Name: NF6853_high_3
Description: NF6853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6853_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 20 - 288
Target Start/End: Original strand, 33827019 - 33827287
Alignment:
| Q |
20 |
atactgactttgaatttcccactattgaatcaatgcaatagtacaatatcttgatattttcatctagctaacatggagtgaaatccatttcatatggaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33827019 |
atactgactttgaatttcccactattgaatcaatgcaatagtacaatatcttgatattttcatctagctaacatggagtgaaatccatttcatatggaaa |
33827118 |
T |
 |
| Q |
120 |
gtgaaaagtactaggaagaaaaattaaagaaggccatgtacaagcacttaatcattagtctactagagaaaacaaaaggaaaatagagaatcatcatcaa |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33827119 |
gtcaaaagtactaggaagaaaaattaaagaaggccatgcacaagcacttaatcattagtctactagagaaaacaaaaggaaaatagagaatcatcatcaa |
33827218 |
T |
 |
| Q |
220 |
ttttctaaacagcaattattatcctatttgtactaaatatgattgagcacaagtgtactcaacccttac |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33827219 |
ttttctaaacagcaattattatcctatttgtactaaatatgattgagcacaagggtactcaacccttac |
33827287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University