View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6853_high_7 (Length: 348)
Name: NF6853_high_7
Description: NF6853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6853_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 38 - 330
Target Start/End: Complemental strand, 43529822 - 43529530
Alignment:
| Q |
38 |
tgcaatcccagcaatagctccactggaaagtgaagacgaagatgatcctcgcttaaacaccggtaaatttgtcgtgttcaactctttcaaactcccatca |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529822 |
tgcaatcccagcaatagctccactggaaagtgaagacgaagatgatcctcgcttaaacaccggtaaatttgtcgtgttcaactctttcaaactcccatca |
43529723 |
T |
 |
| Q |
138 |
tcactaaaactccatgctaaaactctctgcgcttcaatccaattcgttttcgaagctgaaaaaccaaagaacatttcaggagcaacataatgagctataa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529722 |
tcactaaaactccatgctaaaactctctgcgcttcaatccaattcgttttcgaagctgaaaaaccaaagaacatttcaggagcaacataatgagctatac |
43529623 |
T |
 |
| Q |
238 |
tcgaatcattataagatagcgtcggtttcaaaggcttcgaaacaccaaccggagcaacagtaacatttatctccaacctctcgccgtcaaatt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43529622 |
tcgaatcattataagatagcgtcggtttcaaaggcttcgaaacaccaaccggagcaacagtaacatttatctccaacctctcgccgtcaaatt |
43529530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University