View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6853_high_9 (Length: 275)
Name: NF6853_high_9
Description: NF6853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6853_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 7 - 268
Target Start/End: Original strand, 2949336 - 2949597
Alignment:
| Q |
7 |
aaaataatataaatttgtgatttcaaatagtatttcgtgaggttggttgttaaaagagctgtactagtagttggagatagaatagaataattgaaattat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2949336 |
aaaataatataaatttgtgatttcaaatagtttttcgtgaagttggttgttaaaagagctgtactagtagttggagatagaatagaataattgaaattat |
2949435 |
T |
 |
| Q |
107 |
atatctgtctataataaaacactcaatatgttttgttaactgcatacatatatcatatgacatgatgtgttcaattgctagccttgcatgatatgtctct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2949436 |
atatctgtctataataaaacactcaatatgttttgttaactgcatacatatatcatatgacatgatgtgttcaattgctagccttgcatgatatgtctct |
2949535 |
T |
 |
| Q |
207 |
taattacttgggatgcttcctcttctgcacgtcttctttcttcaaggagacattattatttt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2949536 |
taattacttgggatgcttcctcttctgcacgtcttctttcttcaaggagacattattatttt |
2949597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University