View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6853_low_22 (Length: 214)
Name: NF6853_low_22
Description: NF6853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6853_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 36465318 - 36465409
Alignment:
| Q |
20 |
aagttttatgtaaacgttcataatgttggagtggatttggtagcagatatgatgaatgtatatgacatcctcatatgtgacaaatggttggt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465318 |
aagttttatgtaaacgttcataatgttggagtggatttggtagcagatatgatgaaagtatatgacatcctcatatgtgacaaatggttggt |
36465409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University