View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6853_low_22 (Length: 214)

Name: NF6853_low_22
Description: NF6853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6853_low_22
NF6853_low_22
[»] chr1 (1 HSPs)
chr1 (20-111)||(36465318-36465409)


Alignment Details
Target: chr1 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 36465318 - 36465409
Alignment:
20 aagttttatgtaaacgttcataatgttggagtggatttggtagcagatatgatgaatgtatatgacatcctcatatgtgacaaatggttggt 111  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
36465318 aagttttatgtaaacgttcataatgttggagtggatttggtagcagatatgatgaaagtatatgacatcctcatatgtgacaaatggttggt 36465409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University