View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_high_25 (Length: 348)
Name: NF6854_high_25
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_high_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 13 - 273
Target Start/End: Original strand, 4202439 - 4202698
Alignment:
| Q |
13 |
aatctcaaaccgcgtggttgcatgaatgcagcaaatccattaaggaacaaattagtattccttttgtatacaatactaatgtgacaatgaatataaaaaa |
112 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| || |||||||||||||||||| | |||| | |||||||||||||||||||| |||||||||| |
|
|
| T |
4202439 |
aatctcaaatcgcgtggttgcataaatgcagccaacccattaaggaacaaattaatgttccctgcatatacaatactaatgtgacatcaaatataaaaa- |
4202537 |
T |
|
| Q |
113 |
catatagtctatgtttagtattacaaatgaatgtcagaatcacggtaacccacttgannnnnnnaatagcgggtcatcgagactcaatagcttttgcaaa |
212 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||| || ||||||||||| |||||||||||||| |||||| |
|
|
| T |
4202538 |
catagagtctatgtttggtattacaaatgaatgtcagaattacggtaacccacttgatttttttaaaagcgggtcatccagactcaatagcttctgcaaa |
4202637 |
T |
|
| Q |
213 |
atcacgacaggttatcgaattctactatatacatcgtgataccaaacatacacatagtaca |
273 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4202638 |
atcacgacagatcatcgaattctactatatacatcgtgataccaaacatacacatagtaca |
4202698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University