View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_high_36 (Length: 233)
Name: NF6854_high_36
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 7 - 223
Target Start/End: Complemental strand, 36887842 - 36887631
Alignment:
| Q |
7 |
ctcttctcctcaattttgatttctcagagcttgggcgttaactcattcacctgaaggtaacttcgataattgttctagaatctggattatcactgttgaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| | ||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
36887842 |
ctcttctcctcaattttgatttctcagagcttgg-cgttaactcattcagccgaaggtaacttcgataatttttccagaatctggattatcactgttgaa |
36887744 |
T |
 |
| Q |
107 |
tcttgattatctaattttgttattattctgaagttatgatctatttaattaatttgatagtggatatggattaatttagtttttcgatcttttagtaaac |
206 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||| | |||||| || |||||||||| ||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
36887743 |
tcttgattttctaattttgttgttatcctgaaatcatgatccat----ttaatttgattgtggatatggattaatttagtttttggatcttttagtatac |
36887648 |
T |
 |
| Q |
207 |
cctaactttcttgtgat |
223 |
Q |
| |
|
||||| ||||||||||| |
|
|
| T |
36887647 |
cctaattttcttgtgat |
36887631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University