View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_10 (Length: 562)
Name: NF6854_low_10
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 5e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 1 - 153
Target Start/End: Original strand, 34424602 - 34424754
Alignment:
| Q |
1 |
tcaagataccctacatgttcaaaaggtttagcaatttcaagttccaaaaggaggattcttcataccttaaatgatataaagattatgagaaacatggttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34424602 |
tcaagataccctacatgttcaaaaggtttagcaatttcaagttccaaaaggaggattcttcataccttaaatgatataaagattatgagaaatatggttt |
34424701 |
T |
 |
| Q |
101 |
gatatggtaaaaatattgtccagattgtacaatccatgtcacttttaacaagg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34424702 |
gatatggtaaaaatattgtccagattgtacaatccatgtcgcttttaacaagg |
34424754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 171 - 200
Target Start/End: Original strand, 34424768 - 34424797
Alignment:
| Q |
171 |
tctatggggtcttattagtctggaatgtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34424768 |
tctatggggtcttattagtctggaatgtgc |
34424797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University