View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_23 (Length: 436)
Name: NF6854_low_23
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_23 |
 | |
|
| [»] scaffold0293 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 3e-55; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 35618331 - 35618451
Alignment:
| Q |
1 |
tggtttgttcgcttcagatttcgtttcttcgtttattttttgttgtttacccgctagggtggttataaaaagtgtagcttgtcacttgttgtattattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35618331 |
tggtttgttcgcttcagatttcgtttcttcgtttattttttgttgtttacccgctagggtggttataaaaagtgtagcttgtcacttgttgtattattta |
35618430 |
T |
|
| Q |
101 |
tctttaaaggttgattttacac |
122 |
Q |
| |
|
| ||||| |||||||||||||| |
|
|
| T |
35618431 |
t-tttaagggttgattttacac |
35618451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 196 - 270
Target Start/End: Original strand, 35618508 - 35618582
Alignment:
| Q |
196 |
aattgagttaagctcaaggggacacacttttgtttaatatcactggatcagttcatgtcctcatgtctgtcgtac |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
35618508 |
aattgagttaagctcaaggggacacacttttgtttaatatcactggatctgttcatgtccccatgtctgtcgtac |
35618582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 317 - 420
Target Start/End: Original strand, 35618631 - 35618735
Alignment:
| Q |
317 |
taatgaatttaaatttgaggaaagtttatgtacaactacgtgcctgtcttttcgc-nnnnnnnattgcttaacgtttgaaaattaggaacggtgtttttt |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35618631 |
taatgaatttaaatttgaggaaagtttatgtacaactacgtgtctctctttctgctcttttttattgcttaacgtttgaaaattaggaacggtgtttttt |
35618730 |
T |
|
| Q |
416 |
gtatg |
420 |
Q |
| |
|
||||| |
|
|
| T |
35618731 |
gtatg |
35618735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 151 - 192
Target Start/End: Complemental strand, 8078862 - 8078821
Alignment:
| Q |
151 |
ggattcaaaccacatattttgtatatattatacattatctct |
192 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
8078862 |
ggattcaaaccacaaattttatatatattatatattatctct |
8078821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 415
Target Start/End: Original strand, 8511919 - 8511951
Alignment:
| Q |
383 |
cttaacgtttgaaaattaggaacggtgtttttt |
415 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
8511919 |
cttaacgtttgaaaattatgaacggtgtttttt |
8511951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0293 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0293
Description:
Target: scaffold0293; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 420
Target Start/End: Complemental strand, 3903 - 3868
Alignment:
| Q |
385 |
taacgtttgaaaattaggaacggtgttttttgtatg |
420 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3903 |
taacgtttgaaaattatgaacggtgttttttgtatg |
3868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 31 - 95
Target Start/End: Original strand, 22417074 - 22417139
Alignment:
| Q |
31 |
gtttattttttgttgtttacccgctagggt-ggttataaaaagtgtagcttgtcacttgttgtatt |
95 |
Q |
| |
|
|||||||||| ||||||||||| |||||| |||| ||||||||||| |||||||| |||||||| |
|
|
| T |
22417074 |
gtttatttttggttgtttaccctttagggttggttcaaaaaagtgtagtttgtcactcgttgtatt |
22417139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 420
Target Start/End: Original strand, 7205065 - 7205101
Alignment:
| Q |
384 |
ttaacgtttgaaaattaggaacggtgttttttgtatg |
420 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
7205065 |
ttaacgtttgaaaattatgaacggtgttttttttatg |
7205101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 420
Target Start/End: Complemental strand, 19225144 - 19225108
Alignment:
| Q |
384 |
ttaacgtttgaaaattaggaacggtgttttttgtatg |
420 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
19225144 |
ttaacgtttgaaaattatgaacggtgttttttttatg |
19225108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University