View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_27 (Length: 408)
Name: NF6854_low_27
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 23 - 184
Target Start/End: Complemental strand, 4774736 - 4774573
Alignment:
| Q |
23 |
ccgtctcgtcttatttatggcatacagttcaaaatattaaaagaaaa-ttgaatgggggatacatccatctacct-acatacattgaatgaaagaaatat |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
4774736 |
ccgtctcgtcttatttatggcatacaattcaaaatattaaaataaaaattgaatgggggatacatgcatctaccttacatacattgaatgaaagaaatat |
4774637 |
T |
|
| Q |
121 |
tataggtttcactagttcgatcttgcatctaaattttaaaacactagattagatccatgttaaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774636 |
tataggtttcactagttcgatcttgcatctaaattttaaaacactagattagatccatgttaaa |
4774573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 263 - 365
Target Start/End: Complemental strand, 4774573 - 4774469
Alignment:
| Q |
263 |
attaggattttagtctattttggtaacaatggaatttggctcttaatgagattatgaatttcccacgtatatttggtttttacttta--agggtggtagc |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4774573 |
attaggattttagtctattttggtaacaatggaatttggctcttaatgagattatgaatttcccacgtatatttggtttttactttaagagggtggtagc |
4774474 |
T |
|
| Q |
361 |
atctg |
365 |
Q |
| |
|
||||| |
|
|
| T |
4774473 |
atctg |
4774469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University