View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6854_low_27 (Length: 408)

Name: NF6854_low_27
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6854_low_27
NF6854_low_27
[»] chr1 (2 HSPs)
chr1 (23-184)||(4774573-4774736)
chr1 (263-365)||(4774469-4774573)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 8e-71; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 23 - 184
Target Start/End: Complemental strand, 4774736 - 4774573
Alignment:
23 ccgtctcgtcttatttatggcatacagttcaaaatattaaaagaaaa-ttgaatgggggatacatccatctacct-acatacattgaatgaaagaaatat 120  Q
    |||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||    
4774736 ccgtctcgtcttatttatggcatacaattcaaaatattaaaataaaaattgaatgggggatacatgcatctaccttacatacattgaatgaaagaaatat 4774637  T
121 tataggtttcactagttcgatcttgcatctaaattttaaaacactagattagatccatgttaaa 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4774636 tataggtttcactagttcgatcttgcatctaaattttaaaacactagattagatccatgttaaa 4774573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 263 - 365
Target Start/End: Complemental strand, 4774573 - 4774469
Alignment:
263 attaggattttagtctattttggtaacaatggaatttggctcttaatgagattatgaatttcccacgtatatttggtttttacttta--agggtggtagc 360  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||    
4774573 attaggattttagtctattttggtaacaatggaatttggctcttaatgagattatgaatttcccacgtatatttggtttttactttaagagggtggtagc 4774474  T
361 atctg 365  Q
    |||||    
4774473 atctg 4774469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University