View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_34 (Length: 326)
Name: NF6854_low_34
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_34 |
 | |
|
| [»] scaffold0133 (1 HSPs) |
| | |
|
| [»] scaffold0256 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0133 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: scaffold0133
Description:
Target: scaffold0133; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 71 - 150
Target Start/End: Complemental strand, 14552 - 14473
Alignment:
| Q |
71 |
acgagggcttgaaactagacaaatattgtttctatcgcaccaacttctaaccaggttttgcaatcttcgtatagatgcac |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||| ||||||||| |
|
|
| T |
14552 |
acgagggcttgaaactagacaaatattgtttctatcgcaccaacttcttaacagtttttgcaatcttcgtttagatgcac |
14473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 158 - 244
Target Start/End: Original strand, 16875247 - 16875329
Alignment:
| Q |
158 |
tataacagttcaacattaatctctacgtttgaattaaactctaacgataaacaagttacttattatatatccagtgtcacacaagtt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
16875247 |
tataacagttcaacattaatctctacgtttaaattaaactccaacgataaacaagttgcttattata----cagtgtcacacaagtt |
16875329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 210
Target Start/End: Original strand, 16581399 - 16581450
Alignment:
| Q |
159 |
ataacagttcaacattaatctctacgtttgaattaaactctaacgataaaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16581399 |
ataacagttcaacattaatctctacgtttaaattaaactctaacgataaaca |
16581450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 210
Target Start/End: Complemental strand, 16613981 - 16613930
Alignment:
| Q |
159 |
ataacagttcaacattaatctctacgtttgaattaaactctaacgataaaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16613981 |
ataacagttcaacattaatctctacgtttaaattaaactctaacgataaaca |
16613930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 275
Target Start/End: Original strand, 16573431 - 16573480
Alignment:
| Q |
225 |
tatccagtgtcacacaagttcactgctaagagaaactacatatgaaatgta |
275 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
16573431 |
tatccagt-tcacacaagttcaccgctaagagaaactgcatatgaaatgta |
16573480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0256
Description:
Target: scaffold0256; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 10746 - 10703
Alignment:
| Q |
1 |
atttgcttcacatactcactatgatcattttatttttgttttct |
44 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10746 |
atttgcttcacatactcactatcatcattttatttttgttttct |
10703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0256; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 44 - 103
Target Start/End: Complemental strand, 10684 - 10625
Alignment:
| Q |
44 |
tgcacttcatttacattatgnnnnnnnacgagggcttgaaactagacaaatattgtttct |
103 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10684 |
tgcacttcatttacattatgtttttttacgagggcttgaaactagacaaatattgtttct |
10625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University