View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6854_low_39 (Length: 278)
Name: NF6854_low_39
Description: NF6854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6854_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 17 - 165
Target Start/End: Complemental strand, 6332572 - 6332424
Alignment:
| Q |
17 |
gtgttaggcaggtcattgtccattaacagttaccacaccaacaaagggaactagcgctttctttagcatattttagatttaaatagagtaacatactata |
116 |
Q |
| |
|
|||| |||||||||||| | ||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6332572 |
gtgtcaggcaggtcattatgcattaacagttgccacaccaacaaagagaactagtactttctttagcatattttagatttaaatagagtaacatactata |
6332473 |
T |
|
| Q |
117 |
caatgagactcatatatatacaattaggctatgagaaaagagctcaaac |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6332472 |
caatgagactcatatatatacaattaggctatgagaaaagagctcaaac |
6332424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University